Virus:Article Title: Structural and Functional Analysis of the CAPS SNARE-Binding Domain Required for SNARE Complex Formation and Exocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-6 3 His Proteintech Group Cat# 66005-1-lg Mouse monoclonal anti-FLAG Proteintech Group Cat# 66008-2-lg Rabbit polyclonal anti-Munc18-1 Proteintech Group Cat# 11459-1-AP, RRID:AB_2196690 Mouse monoclonal anti-IgG Beyotime Biotechnology Cat# A7028 Rabbit polyclonal anti-Munc13-1 Proteintech Group Cat# 55053-1-AP; RRID:AB_10804173 Mouse monoclonal anti-CAPS Santa Cruz Biotechnology Cat# sc-377279 Rabbit polyclonal anti-Syx1 Proteintech Group Cat# 15556-1-AP; RRID:AB_2198667 Rabbit polyclonal anti-SN25 Proteintech Group Cat# 14903-1-AP; RRID:AB_2192051 Bacterial and Virus Strains One Shot BL21 (DE3) competent cells Invitrogen Cat# C600003 MAX Efficiency DH10Bac Competent Cells GIBCO Cat# 10361012 Chemicals, Peptides, and Recombinant Proteins POPC Avanti Polar Lipids Cat# 850457 POPE Avanti Polar Lipids Cat# 850757 DOPS Avanti Polar Lipids Cat# 840035 DAG Avanti Polar Lipids Cat# 800811 PIP2 Avanti Polar Lipids Cat# 840046 NBD-PE Avanti Polar Lipids Cat# 810144 Rho-PE Avanti Polar Lipids Cat# 810158 BODIPY FL maleimide (BDPY) Thermo Scientific Cat# B10250 Tetramethylrhodamine-5- maleimide (TMR) Thermo Scientific Cat# T6027 IPTG Biofroxx CAS# 367-93-1 DTT SERVA Cat# 20710 b-OG Amresco CAS# 29836-26-8 Triton X-100 Sigma-Aldrich CAS# 9002-93-1 CHAPS Amresco CAS# 75621-03-3 PEG3350 Hampton Research Cat# HR2-527 Succinic acid aladdin CAS# 110-15-6 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited Data CAPS-1 DAMH structure This paper PDB:6A68 Experimental Models: Cell Lines HEK293 cells ATCC Cat# CRL-11268, RRID:CVCL_1926 Sf9 insect cells GIBCO Cat# 11496015 PC12 cells The cell bank of the typical culture deposit committee of Chinese academy of sciences Cat# TCR8 Oligonucleotides CAPS-1 short hairpin RNA (shRNA) targeting sequence: ACAGUGACGAGGAAGAUGAAGAAGACGA Kabachinski et al., 2014 N/A Recombinant DNA pGEX-6p-1-DAMH This paper N/A pGEX-6p-1-DAMH-EHE This paper N/A pGEX-6p-1-DAMH-WDL This paper N/A (Continued on next page) e1 Cell Reports 26, 3347–3359.e1–e6, March 19, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pGEX-6p-1-DAMH-E905K This paper N/A pcDNA3.1-FLAG-CAPS-1 This paper N/A pcDNA3.1-FLAG-DAMH This paper N/A pFastBac-CAPS-1 This paper N/A pEGFP-CAPS-1 This paper N/A pEGFP-CAPS-1-EHE This paper N/A pEGFP-CAPS-1-WDL This paper N/A pEGFP-CAPS-1-E905K This paper N/A pcDNA3.1-CAPS-1 The Laboratory of Thomas F. J. Martin N/A pFHUUIG_shortU6(l309) The Laboratory of Xiaofei Yang N/A NPY-td-Orange2 Addgene Addgene Plasmid # 83497 Software and Algorithms ImageJ 1.50d National Institutes of Health (NIH) https://imagej.nih.gov/ij/ Prism 6.0 GraphPad https://www.graphpad.com/scientific- software/prism/ PyMol 1.5.0.1 DeLano Scientific https://pymol.org/2/ Icy 1.9.8.1 BioImage Analysis unit Institut Pasteur http://icy.bioimageanalysis.org/
Recombinant:Article Title: Structural and Functional Analysis of the CAPS SNARE-Binding Domain Required for SNARE Complex Formation and Exocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-6 3 His Proteintech Group Cat# 66005-1-lg Mouse monoclonal anti-FLAG Proteintech Group Cat# 66008-2-lg Rabbit polyclonal anti-Munc18-1 Proteintech Group Cat# 11459-1-AP, RRID:AB_2196690 Mouse monoclonal anti-IgG Beyotime Biotechnology Cat# A7028 Rabbit polyclonal anti-Munc13-1 Proteintech Group Cat# 55053-1-AP; RRID:AB_10804173 Mouse monoclonal anti-CAPS Santa Cruz Biotechnology Cat# sc-377279 Rabbit polyclonal anti-Syx1 Proteintech Group Cat# 15556-1-AP; RRID:AB_2198667 Rabbit polyclonal anti-SN25 Proteintech Group Cat# 14903-1-AP; RRID:AB_2192051 Bacterial and Virus Strains One Shot BL21 (DE3) competent cells Invitrogen Cat# C600003 MAX Efficiency DH10Bac Competent Cells GIBCO Cat# 10361012 Chemicals, Peptides, and Recombinant Proteins POPC Avanti Polar Lipids Cat# 850457 POPE Avanti Polar Lipids Cat# 850757 DOPS Avanti Polar Lipids Cat# 840035 DAG Avanti Polar Lipids Cat# 800811 PIP2 Avanti Polar Lipids Cat# 840046 NBD-PE Avanti Polar Lipids Cat# 810144 Rho-PE Avanti Polar Lipids Cat# 810158 BODIPY FL maleimide (BDPY) Thermo Scientific Cat# B10250 Tetramethylrhodamine-5- maleimide (TMR) Thermo Scientific Cat# T6027 IPTG Biofroxx CAS# 367-93-1 DTT SERVA Cat# 20710 b-OG Amresco CAS# 29836-26-8 Triton X-100 Sigma-Aldrich CAS# 9002-93-1 CHAPS Amresco CAS# 75621-03-3 PEG3350 Hampton Research Cat# HR2-527 Succinic acid aladdin CAS# 110-15-6 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited Data CAPS-1 DAMH structure This paper PDB:6A68 Experimental Models: Cell Lines HEK293 cells ATCC Cat# CRL-11268, RRID:CVCL_1926 Sf9 insect cells GIBCO Cat# 11496015 PC12 cells The cell bank of the typical culture deposit committee of Chinese academy of sciences Cat# TCR8 Oligonucleotides CAPS-1 short hairpin RNA (shRNA) targeting sequence: ACAGUGACGAGGAAGAUGAAGAAGACGA Kabachinski et al., 2014 N/A Recombinant DNA pGEX-6p-1-DAMH This paper N/A pGEX-6p-1-DAMH-EHE This paper N/A pGEX-6p-1-DAMH-WDL This paper N/A (Continued on next page) e1 Cell Reports 26, 3347–3359.e1–e6, March 19, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pGEX-6p-1-DAMH-E905K This paper N/A pcDNA3.1-FLAG-CAPS-1 This paper N/A pcDNA3.1-FLAG-DAMH This paper N/A pFastBac-CAPS-1 This paper N/A pEGFP-CAPS-1 This paper N/A pEGFP-CAPS-1-EHE This paper N/A pEGFP-CAPS-1-WDL This paper N/A pEGFP-CAPS-1-E905K This paper N/A pcDNA3.1-CAPS-1 The Laboratory of Thomas F. J. Martin N/A pFHUUIG_shortU6(l309) The Laboratory of Xiaofei Yang N/A NPY-td-Orange2 Addgene Addgene Plasmid # 83497 Software and Algorithms ImageJ 1.50d National Institutes of Health (NIH) https://imagej.nih.gov/ij/ Prism 6.0 GraphPad https://www.graphpad.com/scientific- software/prism/ PyMol 1.5.0.1 DeLano Scientific https://pymol.org/2/ Icy 1.9.8.1 BioImage Analysis unit Institut Pasteur http://icy.bioimageanalysis.org/
Western Blot:Article Title: Structural and Functional Analysis of the CAPS SNARE-Binding Domain Required for SNARE Complex Formation and Exocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-6 3 His Proteintech Group Cat# 66005-1-lg Mouse monoclonal anti-FLAG Proteintech Group Cat# 66008-2-lg Rabbit polyclonal anti-Munc18-1 Proteintech Group Cat# 11459-1-AP, RRID:AB_2196690 Mouse monoclonal anti-IgG Beyotime Biotechnology Cat# A7028 Rabbit polyclonal anti-Munc13-1 Proteintech Group Cat# 55053-1-AP; RRID:AB_10804173 Mouse monoclonal anti-CAPS Santa Cruz Biotechnology Cat# sc-377279 Rabbit polyclonal anti-Syx1 Proteintech Group Cat# 15556-1-AP; RRID:AB_2198667 Rabbit polyclonal anti-SN25 Proteintech Group Cat# 14903-1-AP; RRID:AB_2192051 Bacterial and Virus Strains One Shot BL21 (DE3) competent cells Invitrogen Cat# C600003 MAX Efficiency DH10Bac Competent Cells GIBCO Cat# 10361012 Chemicals, Peptides, and Recombinant Proteins POPC Avanti Polar Lipids Cat# 850457 POPE Avanti Polar Lipids Cat# 850757 DOPS Avanti Polar Lipids Cat# 840035 DAG Avanti Polar Lipids Cat# 800811 PIP2 Avanti Polar Lipids Cat# 840046 NBD-PE Avanti Polar Lipids Cat# 810144 Rho-PE Avanti Polar Lipids Cat# 810158 BODIPY FL maleimide (BDPY) Thermo Scientific Cat# B10250 Tetramethylrhodamine-5- maleimide (TMR) Thermo Scientific Cat# T6027 IPTG Biofroxx CAS# 367-93-1 DTT SERVA Cat# 20710 b-OG Amresco CAS# 29836-26-8 Triton X-100 Sigma-Aldrich CAS# 9002-93-1 CHAPS Amresco CAS# 75621-03-3 PEG3350 Hampton Research Cat# HR2-527 Succinic acid aladdin CAS# 110-15-6 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited Data CAPS-1 DAMH structure This paper PDB:6A68 Experimental Models: Cell Lines HEK293 cells ATCC Cat# CRL-11268, RRID:CVCL_1926 Sf9 insect cells GIBCO Cat# 11496015 PC12 cells The cell bank of the typical culture deposit committee of Chinese academy of sciences Cat# TCR8 Oligonucleotides CAPS-1 short hairpin RNA (shRNA) targeting sequence: ACAGUGACGAGGAAGAUGAAGAAGACGA Kabachinski et al., 2014 N/A Recombinant DNA pGEX-6p-1-DAMH This paper N/A pGEX-6p-1-DAMH-EHE This paper N/A pGEX-6p-1-DAMH-WDL This paper N/A (Continued on next page) e1 Cell Reports 26, 3347–3359.e1–e6, March 19, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pGEX-6p-1-DAMH-E905K This paper N/A pcDNA3.1-FLAG-CAPS-1 This paper N/A pcDNA3.1-FLAG-DAMH This paper N/A pFastBac-CAPS-1 This paper N/A pEGFP-CAPS-1 This paper N/A pEGFP-CAPS-1-EHE This paper N/A pEGFP-CAPS-1-WDL This paper N/A pEGFP-CAPS-1-E905K This paper N/A pcDNA3.1-CAPS-1 The Laboratory of Thomas F. J. Martin N/A pFHUUIG_shortU6(l309) The Laboratory of Xiaofei Yang N/A NPY-td-Orange2 Addgene Addgene Plasmid # 83497 Software and Algorithms ImageJ 1.50d National Institutes of Health (NIH) https://imagej.nih.gov/ij/ Prism 6.0 GraphPad https://www.graphpad.com/scientific- software/prism/ PyMol 1.5.0.1 DeLano Scientific https://pymol.org/2/ Icy 1.9.8.1 BioImage Analysis unit Institut Pasteur http://icy.bioimageanalysis.org/
shRNA:Article Title: Structural and Functional Analysis of the CAPS SNARE-Binding Domain Required for SNARE Complex Formation and Exocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-6 3 His Proteintech Group Cat# 66005-1-lg Mouse monoclonal anti-FLAG Proteintech Group Cat# 66008-2-lg Rabbit polyclonal anti-Munc18-1 Proteintech Group Cat# 11459-1-AP, RRID:AB_2196690 Mouse monoclonal anti-IgG Beyotime Biotechnology Cat# A7028 Rabbit polyclonal anti-Munc13-1 Proteintech Group Cat# 55053-1-AP; RRID:AB_10804173 Mouse monoclonal anti-CAPS Santa Cruz Biotechnology Cat# sc-377279 Rabbit polyclonal anti-Syx1 Proteintech Group Cat# 15556-1-AP; RRID:AB_2198667 Rabbit polyclonal anti-SN25 Proteintech Group Cat# 14903-1-AP; RRID:AB_2192051 Bacterial and Virus Strains One Shot BL21 (DE3) competent cells Invitrogen Cat# C600003 MAX Efficiency DH10Bac Competent Cells GIBCO Cat# 10361012 Chemicals, Peptides, and Recombinant Proteins POPC Avanti Polar Lipids Cat# 850457 POPE Avanti Polar Lipids Cat# 850757 DOPS Avanti Polar Lipids Cat# 840035 DAG Avanti Polar Lipids Cat# 800811 PIP2 Avanti Polar Lipids Cat# 840046 NBD-PE Avanti Polar Lipids Cat# 810144 Rho-PE Avanti Polar Lipids Cat# 810158 BODIPY FL maleimide (BDPY) Thermo Scientific Cat# B10250 Tetramethylrhodamine-5- maleimide (TMR) Thermo Scientific Cat# T6027 IPTG Biofroxx CAS# 367-93-1 DTT SERVA Cat# 20710 b-OG Amresco CAS# 29836-26-8 Triton X-100 Sigma-Aldrich CAS# 9002-93-1 CHAPS Amresco CAS# 75621-03-3 PEG3350 Hampton Research Cat# HR2-527 Succinic acid aladdin CAS# 110-15-6 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited Data CAPS-1 DAMH structure This paper PDB:6A68 Experimental Models: Cell Lines HEK293 cells ATCC Cat# CRL-11268, RRID:CVCL_1926 Sf9 insect cells GIBCO Cat# 11496015 PC12 cells The cell bank of the typical culture deposit committee of Chinese academy of sciences Cat# TCR8 Oligonucleotides CAPS-1 short hairpin RNA (shRNA) targeting sequence: ACAGUGACGAGGAAGAUGAAGAAGACGA Kabachinski et al., 2014 N/A Recombinant DNA pGEX-6p-1-DAMH This paper N/A pGEX-6p-1-DAMH-EHE This paper N/A pGEX-6p-1-DAMH-WDL This paper N/A (Continued on next page) e1 Cell Reports 26, 3347–3359.e1–e6, March 19, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pGEX-6p-1-DAMH-E905K This paper N/A pcDNA3.1-FLAG-CAPS-1 This paper N/A pcDNA3.1-FLAG-DAMH This paper N/A pFastBac-CAPS-1 This paper N/A pEGFP-CAPS-1 This paper N/A pEGFP-CAPS-1-EHE This paper N/A pEGFP-CAPS-1-WDL This paper N/A pEGFP-CAPS-1-E905K This paper N/A pcDNA3.1-CAPS-1 The Laboratory of Thomas F. J. Martin N/A pFHUUIG_shortU6(l309) The Laboratory of Xiaofei Yang N/A NPY-td-Orange2 Addgene Addgene Plasmid # 83497 Software and Algorithms ImageJ 1.50d National Institutes of Health (NIH) https://imagej.nih.gov/ij/ Prism 6.0 GraphPad https://www.graphpad.com/scientific- software/prism/ PyMol 1.5.0.1 DeLano Scientific https://pymol.org/2/ Icy 1.9.8.1 BioImage Analysis unit Institut Pasteur http://icy.bioimageanalysis.org/
Sequencing:Article Title: Structural and Functional Analysis of the CAPS SNARE-Binding Domain Required for SNARE Complex Formation and Exocytosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-6 3 His Proteintech Group Cat# 66005-1-lg Mouse monoclonal anti-FLAG Proteintech Group Cat# 66008-2-lg Rabbit polyclonal anti-Munc18-1 Proteintech Group Cat# 11459-1-AP, RRID:AB_2196690 Mouse monoclonal anti-IgG Beyotime Biotechnology Cat# A7028 Rabbit polyclonal anti-Munc13-1 Proteintech Group Cat# 55053-1-AP; RRID:AB_10804173 Mouse monoclonal anti-CAPS Santa Cruz Biotechnology Cat# sc-377279 Rabbit polyclonal anti-Syx1 Proteintech Group Cat# 15556-1-AP; RRID:AB_2198667 Rabbit polyclonal anti-SN25 Proteintech Group Cat# 14903-1-AP; RRID:AB_2192051 Bacterial and Virus Strains One Shot BL21 (DE3) competent cells Invitrogen Cat# C600003 MAX Efficiency DH10Bac Competent Cells GIBCO Cat# 10361012 Chemicals, Peptides, and Recombinant Proteins POPC Avanti Polar Lipids Cat# 850457 POPE Avanti Polar Lipids Cat# 850757 DOPS Avanti Polar Lipids Cat# 840035 DAG Avanti Polar Lipids Cat# 800811 PIP2 Avanti Polar Lipids Cat# 840046 NBD-PE Avanti Polar Lipids Cat# 810144 Rho-PE Avanti Polar Lipids Cat# 810158 BODIPY FL maleimide (BDPY) Thermo Scientific Cat# B10250 Tetramethylrhodamine-5- maleimide (TMR) Thermo Scientific Cat# T6027 IPTG Biofroxx CAS# 367-93-1 DTT SERVA Cat# 20710 b-OG Amresco CAS# 29836-26-8 Triton X-100 Sigma-Aldrich CAS# 9002-93-1 CHAPS Amresco CAS# 75621-03-3 PEG3350 Hampton Research Cat# HR2-527 Succinic acid aladdin CAS# 110-15-6 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited Data CAPS-1 DAMH structure This paper PDB:6A68 Experimental Models: Cell Lines HEK293 cells ATCC Cat# CRL-11268, RRID:CVCL_1926 Sf9 insect cells GIBCO Cat# 11496015 PC12 cells The cell bank of the typical culture deposit committee of Chinese academy of sciences Cat# TCR8 Oligonucleotides CAPS-1 short hairpin RNA (shRNA) targeting sequence: ACAGUGACGAGGAAGAUGAAGAAGACGA Kabachinski et al., 2014 N/A Recombinant DNA pGEX-6p-1-DAMH This paper N/A pGEX-6p-1-DAMH-EHE This paper N/A pGEX-6p-1-DAMH-WDL This paper N/A (Continued on next page) e1 Cell Reports 26, 3347–3359.e1–e6, March 19, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER pGEX-6p-1-DAMH-E905K This paper N/A pcDNA3.1-FLAG-CAPS-1 This paper N/A pcDNA3.1-FLAG-DAMH This paper N/A pFastBac-CAPS-1 This paper N/A pEGFP-CAPS-1 This paper N/A pEGFP-CAPS-1-EHE This paper N/A pEGFP-CAPS-1-WDL This paper N/A pEGFP-CAPS-1-E905K This paper N/A pcDNA3.1-CAPS-1 The Laboratory of Thomas F. J. Martin N/A pFHUUIG_shortU6(l309) The Laboratory of Xiaofei Yang N/A NPY-td-Orange2 Addgene Addgene Plasmid # 83497 Software and Algorithms ImageJ 1.50d National Institutes of Health (NIH) https://imagej.nih.gov/ij/ Prism 6.0 GraphPad https://www.graphpad.com/scientific- software/prism/ PyMol 1.5.0.1 DeLano Scientific https://pymol.org/2/ Icy 1.9.8.1 BioImage Analysis unit Institut Pasteur http://icy.bioimageanalysis.org/
|